Disruption in the normal functioning of specific micro ribonucleic acids (miRNAs), namely miR-30a-5p, miR-126-3p and miR-182-5p, is strongly linked to initiation and advancement of type 2 diabetes mellitus (T2DM).
Aim
This study examined the effect of high glucose (HG) on the expression of selected miRNAs and their target genes in HepG2 cells and assessed the modulatory effects of resveratrol (RES), a polyphenol with known anti-diabetic properties.
Setting
This was a laboratory-based study conducted at the South African Medical Research Council (SAMRC)/Cape Peninsula University of Technology (CPUT) Cardiometabolic Health Research Unit at the CPUT Bellville campus, Cape Town, South Africa.
Methods
HepG2 cells were treated with HG (40 mM) and RES (low resveratrol [LR] 25 µM and high resveratrol [HR] 50 µM) for 48 h and 72 h. The expression levels of miR-30a-5p, miR-126-3p and miR-182-5p, and their target genes (Sprouty-related EVH1 domain containing 1 [SPRED1], Forkhead box O1 [FOXO1], Glucose-6-phosphatase [G6Pase], and Neuronal differentiation 1 [Neurod1]) were quantified using quantitative polymerase chain reaction (qPCR). Sirtuin 1 (SIRT1) messenger ribonucleic acid (mRNA) levels were also assessed, and the protein expression was measured using enzyme-linked immunosorbent assay (ELISA).
Results
Exposure to HG for 48 h and 72 h decreased the expression of miR-126-3p and miR-182-5p, while increasing the expression level of its target genes SPRED1, FOXO1 and G6Pase. MiR-30a-5p was similarly decreased under HG, while Neurod1 expression was increased in HepG2 cells. RES treatment reversed these effects, restoring miRNA expression and decreasing their target genes. Additionally, HG decreased both mRNA and protein expression of SIRT1, while treatment with RES counteracted these effects, increasing SIRT1 expression.
Conclusion
Our results suggest that RES may influence metabolic regulation and miRNA–gene interactions under HG conditions in HepG2 cells.
Contribution
This study provides preliminary insights into mechanisms relevant to glucose-induced metabolic dysregulation.
resveratrolSIRT1miR-30a-5pmiR-126-3pmiR-182-5pFunding information The current study was supported by the South African Medical Research Council (SAMRC), through grants provided by the National Treasury under its Economic Competitiveness and Support Package (MRC–RFA–UFSP–01–2013/VMH Study) and the South African National Research Foundation (SANRF) (Grant no. 115450).Introduction
Diabetes mellitus (DM) is a metabolic disorder characterised by impaired insulin production or function, caused by both genetic and environmental factors, and ultimately affecting glucose metabolism.1 In 2021, approximately 24 million people in Africa were living with diabetes. This figure is projected to rise to 55 million by 2045.2 Between 2010 and 2019, the incidence of diabetes in South Africa rose from 4.5% to 12.7%. In 2019, an estimated 4.58 million South Africans aged 20 years to 79 years had diabetes, with 52.4% remaining undiagnosed.3 Current diabetes treatments are associated with adverse effects, such as weight gain, hypoglycaemia, gastrointestinal discomfort and contraindications that may limit their clinical application.4,5 Early identification and effective treatment of diabetes are crucial for improving patient outcomes.
Emerging evidence indicates that circulating micro ribonucleic acids (miRNAs) play a pivotal role in the onset and progression of diabetes. Micro ribonucleic acids are endogenous noncoding ribonucleic acids (RNAs) that regulate gene expression post-transcriptionally. They function by promoting messenger RNA (mRNA) degradation or inhibiting mRNA translation into proteins.6,7 Many studies8,9 have focused on miRNAs specific to African populations. A study by Weale et al. demonstrated that dysregulation of specific miRNAs, including miR-30a-5p, miR-126-3p and miR-182-5p, is associated with the development and progression of type 2 diabetes mellitus (T2DM) in the South African population residing in the Western Cape.8,9 These miRNAs were found to be overexpressed in individuals with prediabetes or T2DM, indicating their potential as biomarkers for early detection of prediabetes or T2DM in patients.
Such findings provided a foundational framework for the current study. Dysregulation of these miRNAs has been associated with diabetes-related pathways. For instance, studies have shown that miR-182 influences glucose metabolism, mainly by targeting Forkhead box protein O1 (FOXO1).10,11 Reduced miR-182 levels can lead to hyperglycaemia by allowing FOXO1 to enhance G6Pase transcription, thereby increasing gluconeogenesis.12 In addition, miR-126 is essential for regulating vascular development and stability by targeting specific mRNAs, including CXCL12, VCAM-1, SPRED1 and PIK3R2. These targets are implicated in the endothelial dysfunction associated with diabetes and its complications.13,14
Furthermore, previous research shows that miR-30a-5p is upregulated in a glucotoxic environment. The elevated expression of miR-30a-5p leads to beta-cell dysfunction by directly inhibiting Beta2/NeuroD, a transcription factor important for the development of the endocrine pancreas.15 The inhibition of Beta2/NeuroD results in reduced insulin levels and impaired glucose responsiveness, worsening hyperglycaemia. Moreover, miR-30a-5p belongs to the miR-30 family, which is implicated in the pathogenesis of T2DM, including insulin activation and platelet activation.16 Natural products have been recognised for their therapeutic properties for a long time.17 Resveratrol (RES), a polyphenol phytoalexin also known as trans-3,4,5-trihydroxystilbene, is present in various plants, including grapes, peanuts and berries.17 Numerous studies have examined the role of RES in the management of diabetes and its related complications.18,19,21 Several studies have demonstrated that RES can reduce blood glucose levels.22,23,24,25,26 Resveratrol may exert its anti-hyperglycaemic effects through the activation of sirtuin 1 (SIRT1), an NAD+-dependent deacetylase that serves as a regulator of parameters influencing T2DM.27,28,29,30 Various studies report a reduction in SIRT1 activity and expression in both in vitro and in vivo experimental models of diabetes.31,32 Moreover, SIRT1 is an important regulator of cellular activities and has been shown to interact with miRNAs.33 miR-182-5p, miR-30a-5p and miR-126-3p have been found to be involved in glucose metabolism, insulin signalling and inflammation,8,34,35 processes in which SIRT1 is recognised to exert a regulatory influence.36,37
Given the link between SIRT1 and miRNA-mediated metabolic pathways, investigating the impact of RES on these miRNAs could provide significant insight into its potential therapeutic advantages. Therefore, this study sought to evaluate the expression levels of miR-30a-5p, miR-126-3p and miR-182-5p in HepG2 cells exposed to high glucose (HG) concentrations and to observe the effects of RES on these miRNAs under HG and control conditions. In addition, the study aimed to examine the impact of glucose-induced miRNA dysregulation on specific genes (mRNA expression) involved in glucose metabolism and hyperglycaemia.
Research methods and designCell culture
The cells were categorised into six groups according to our prior research.38,39,40 Donated HepG2 cells were cultivated in a monolayer in 25 cm3 flasks, at a density of 106 cells per flask. Eagle’s minimum essential medium (EMEM) was supplemented with 10% foetal bovine serum (FBS), 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL amphotericin B and 4 mM L-glutamine. Cultures were maintained in a 37 °C humidified incubator with 5% carbon dioxide (CO2). Cells were rinsed with 0.1 M phosphate-buffered saline (PBS). Upon reaching 70% – 80% confluence, cells were treated with two concentrations of resveratrol (low resveratrol [LR] 25 µM, high resveratrol [HR] 50 µM) and HG (40 mM) for 48 h and 72 h, respectively.38,39,40 Cells were then harvested and assessed using the trypan blue exclusion technique.38 Total cell counts and viability were determined according to established protocols.38,40
Resveratrol treatments
Resveratrol stock solutions (20 mM) were prepared in 100% dimethyl sulphoxide (DMSO). Treatment concentrations of RES were selected based on the 50% inhibitory concentration (IC50) reported in previous studies.41,42,43 Untreated control cells and the HG group did not receive the vehicle (DMSO). Previous investigations of RES’s metabolic effects in HepG2 cells included a vehicle control, in which cells were treated with DMSO only, to account for potential solvent effects.44
Micro ribonucleic acids isolation
Micro ribonucleic acids were extracted using the miRNeasy Tissue/Cells Advanced Minikit (Qiagen) in accordance with the manufacturer’s instructions. The concentration of isolated miRNA was determined with a NanoDrop™ spectrophotometer (NanoDrop™ OneC, Thermo Fisher Scientific, Wilmington, DE, United States). Complementary deoxyribonucleic acid (cDNA) synthesis was performed using the miRCURY LNA RT kit (Qiagen) according to the manufacturer’s protocol. Following cDNA synthesis, samples were stored at −20 °C until required for quantitative polymerase chain reaction (qPCR) assays.
Micro ribonucleic acids analysis
Micro ribonucleic acids expression analysis was conducted using the miRCURY® LNA® miRNA SYBR® Green PCR kit (Qiagen) according to the manufacturer’s protocol and quantified with the Applied BiosystemsTM QuantStudioTM 7 Flex system (Thermo Fisher Scientific). Target miRNAs were synthesised using pre-designed, miRNA-specific primers. The primers included hsa-miR-182-5p (Catalogue [CAT] no: YP00206070), hsa-miR-30a-5p (CAT no: YP00205695) and hsa-miR-126-3p (CAT no: YP00204227) (Qiagen). Cycle threshold (Ct) values were collected and normalised to the endogenous control (U6 snRNA, CAT: YP02119464). Micro ribonucleic acids expression levels in each sample were quantified using the 2−ΔCt method, and the 2−ΔΔCt value was used to compare miRNA expression levels in each sample with the control.45
Ribonucleic acids extraction and gene expression analysis
Total RNA isolation was conducted using QIAzol® extraction reagent (Qiagen) following established protocols.38 Ribonucleic acid quantification was performed using NanoDrop™ spectrometry (NanoDrop™ OneC). The iScript cDNA synthesis kit (Bio-Rad) was used to synthesise cDNA following the manufacturer’s instructions. After cDNA conversion, mRNA amplification was performed using the Applied BiosystemsTM QuantStudioTM 7 Flex system. The reaction mixture was prepared following the methodology established in our previous studies,38,39,40 utilising SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad). Primers utilised in this study (Table 1) were sourced from Inqaba Biotechnical Industries.39,40Beta-actin served as the housekeeping gene in the experiment. The mRNA expression level in each sample was quantified using Livak’s method.45
Primers used in this study.
Gene name
Forward
Reverse
Beta-actin
5′ TGACGGGTCACCCACACTGTGCCCAT 3′
5′CTAGAAGCATTTGCGGTGGACGATGGAGGG 3′
Neurdod1
5′ CTCCGGGGTTATGAGATCGTCAC 3′
5′ GCCTTCATGCGCCTTAATTT 3′
FOXO1
5′ AAGCTCCCAAGTGACTTGGATG 3′
5′ CTGCTCACTAACCCTCAGCCTGA 3′
G6P
5′ TTTCCCCACCAGGTCGTGGCT 3′
5′ CCCATTCTGGCCGCTCACAC 3′
Enzyme-linked immunosorbent assay
The culture supernatant collected after 48 h and 72 h of treatment was used to detect human SIRT1 (CAT: EH427RB, Invitrogen, Thermo Fisher Scientific) according to the manufacturer’s protocol. An ELISA plate reader was used to measure the absorbance at 450 nm.
Statistical analysis
Data analyses were performed using GraphPad Prism version 8.0.0 (GraphPad Software, San Diego, California, United States). Student’s t-test and one-way analysis of variance (ANOVA) were used to compare means between the treatment groups. The data were presented as means ± standard deviation (s.d.). All experiments were performed in triplicate technical replicates, and p-values < 0.05 were considered statistically significant.
Ethical considerations
Ethical clearance to conduct this study was obtained from the Health and Wellness Sciences Research Ethics Committee (HWS-REC) of Cape Peninsula University of Technology (No. CPUT/HWS-REC 2021/H6).
ResultsExpression levels of miR-126-3p and SPRED1 in HepG2 cells treated with high glucose and resveratrol
miR-126-3p levels decreased significantly compared with the control group following exposure to HG for 48 h and 72 h (p < 0.0001; Figure 1). No significant differences in miR-126-3p were observed after exposure to LR (25 µM) over 48 h and 72 h compared to controls. However, miR-126-3p was significantly decreased after exposure to HR (50 µM) for 48 h and 72 h (p < 0.001 and p = 0.0015; Figure 1). Because HG exposure reduced miR-126-3p expression, we aimed to determine whether RES could mitigate HG-induced downregulation of this miRNA. The cells were treated with HG + LR and HG + HR for 48 h and 72 h (Figure 1). A significant increase in miR-126-3p levels was observed after exposure to HG + LR and HG + HR for 48 h (p < 0.001; Figure 1) and 72 h (p = 0.0001 and p = 0.0008; Figure 1) compared to HG alone.
Expression of miR-126-3p (a and b) and SPRED1 messenger RNA (c and d) in HepG2 cells treated with high glucose (40 mM) and resveratrol (25 µM and 50 µM) over 48 h and 72 h.
Micro ribonucleic acids are widely recognised for repressing the expression of specific target genes. According to the miRDB-microRNA target prediction database, miR-126-3p targets SPRED1 (http://www.mirdb.org/). Therefore, SPRED1 mRNA expression was examined. SPRED1 showed a statistically significant increase following treatment with HG for 48 h and 72 h (p < 0.0001; Figure 1) compared to controls. After cells were subjected to LR and HR treatments for 48 h, SPRED1 mRNA expression decreased significantly (p = 0.002 and p = 0.0019). When cells were treated with LR and HR for 72 h, no noticeable SPRED1 expression was observed. However, cells treated with HR exhibited a significant reduction (p < 0.0001) compared to controls. Interestingly, SPRED1 expression was reduced by 48 h and 72 h of exposure to HG + LR and HG + HR (p < 0.0001; Figure 1), compared to HG alone.
Expression of miR-182-5p and its target gene (<italic>FOXO1</italic>) in HepG2 cells
Exposure of cells to HG resulted in a significant reduction in miR-182-5p expression (p < 0.0001) and an increase in FOXO1 expression at both 48 h and 72 h (p = 0.0141 and p < 0.0001, respectively; Figure 2) compared to controls. Treatment with LR did not significantly affect miR-182-5p expression, whereas HR treatment significantly decreased miR-182-5p expression (p < 0.0001) compared to the control. Treatment with LR and HR alone for 72 h resulted in a significant decrease in miR-182-5p expression levels (p = 0.0003 and p < 0.0001, respectively; Figure 2). Additionally, FOXO1 expression was significantly reduced following LR and HR treatment at both 48 h and 72 h (p < 0.0001; Figure 2) relative to the control. The expression of miR-126-3p significantly increased following exposure to HG + LR and HG + HR over 48 h and 72 h (p < 0.0001; Figure 2), compared to the HG group alone. Forkhead box protein O1 levels were also elevated in response to HG + LR and HG + HR treatments at both 48 h (p = 0.0475 and p = 0.0002, respectively) and 72 h (p < 0.0001), relative to HG alone (Figure 2). Increased miR-182-5p expression was associated with reduced FOXO1 expression (Figure 2).
Expression of miR-182-5p (a and b) and FOXO1 messenger RNA (c and d) in HepG2 cells treated with high glucose (40 mM) and resveratrol (25 µM and 50 µM) over 48 h and 72 h.
Increased expression of <italic>FOXO1</italic> mRNA accompanied by increased expression of G6Pase in HepG2 cells
Our results showed a substantial increase in FOXO1 mRNA at 48 h and 72 h of treatment with HG (p < 0.0001; Figure 3). Treatment of cells with LR and HR alone for 48 h and 72 h resulted in a significant reduction compared to the control group (p < 0.0001). Additionally, exposure to HG + LR and HG + HR for 48 h and 72 h led to a substantial decrease in G6Pase expression relative to the HG group (p < 0.001; Figure 3).
The messenger ribonucleic acid expression of G6Pase in HepG2 cells treated with high glucose (40 mM) and resveratrol (25 µM and 50 µM) over 48 h (a) and 72 h (b).
Expression of miR-30a-5p and Neurod1 in HepG2 cells
The miRDB-microRNA target prediction database indicated that miR-30a-5p targets Neurod1 (http://www.mirdb.org/). Cells treated with HG showed a significant decrease in miR-30a-5p at 48 h and 72 h (p < 0.0001; Figure 4) compared to controls. In contrast, Neurod1 expression was significantly increased after 72 h of HG treatment (p < 0.0001). Nevertheless, no statistically significant result was observed after 48 h of treatment (Figure 4). Following 48 h of LR and HR treatment, the LR group showed no statistical change in miR-30a-5p expression, whereas HR treatment resulted in a significant reduction in miR-30a-5p expression compared to controls (p = 0.0002; Figure 4). After 72 h of LR and HR treatment, miR-30a-5p expression levels were significantly decreased compared to controls (p < 0.0001; Figure 4). Neurod1 expression was significantly reduced in cells exposed to LR and HR alone for both 48 h and 72 h (p < 0.0001; Figure 4) compared to controls. In contrast, miR-30a-5p levels were significantly increased following HG + LR and HG + HR treatment for 48 h and 72 h (p < 0.0001; Figure 4) compared to HG treatment alone. Cells treated with HG + LR and HG + HR also exhibited a significant decrease in Neurod1 mRNA after 48 h and 72 h (p < 0.0001) compared to cells treated with HG alone.
Expression of miR-30a-5p (a and b) and Neurod1 messenger RNA (c and d) in HepG2 cells treated with high glucose (40 mM) and resveratrol (25 µM and 50 µM) over 48 h and 72 h.
The messenger RNA and protein expression of Sirtuin 1
The mRNA expression levels of SIRT1 were significantly decreased following exposure to HG for 72 h (p = 0.0003; Figure 5). In contrast, no statistically significant difference was observed after 48 h of HG exposure (Figure 5).39 Consistently, ELISA results demonstrated that SIRT1 concentration was significantly reduced in HepG2 cells after 48 h and 72 h of HG exposure (Figure 5, p = 0.001 and p = 0.0023, respectively). When HepG2 cells were cultured with LR and HR for 48 h, the mRNA expression of SIRT1 was significantly increased (p = 0.0004 and p < 0.0001, respectively; Figure 5). When cells were exposed to LR and HR for 72 h, HR significantly increased the mRNA expression of SIRT1 (p = 0.002); however, no statistical difference was observed when exposed to LR (Figure 5).39 Enzyme-linked immunosorbent assay results indicated no statistical difference in SIRT1 concentration when HepG2 cells were cultured with LR and HR for 48 h (Figure 5). However, a statistically significant difference was observed after 72 h of incubation (p = 0.0470 and p = 0.0176; Figure 5). Exposure of HepG2 cells to LR and HR in the presence of HG for both 48 h and 72 h resulted in a significant increase in SIRT1 mRNA expression compared to HG alone (p < 0.0001; Figure 5).39 Enzyme-linked immunosorbent assay analysis showed no statistical difference in SIRT1 concentration when HepG2 cells were treated with LR + HG for 48 and 72 h. In contrast, exposure to HR + HG for 48 h and 72 h significantly increased SIRT1 concentration (p = 0.0240 and p = 0.0067, respectively, Figure 5).
SIRT1 mRNA expression (a and b) and protein expression of SIRT1 (c and d) after exposure to high glucose (40 mM) and resveratrol (25 µM and 50 µM) over 48 h and 72 h.
Discussion
Our findings demonstrated that exposure of HepG2 cells to HG for 48 h and 72 h resulted in significant decreases in miR-126-3p, miR-182-5p and miR-30a-5p. MiR-126-3p is recognised as a key regulator of vascular development and homeostasis, and its reduced expression is linked to endothelial dysfunction in diabetes.9,46 MiR-182-5p has been linked with the development of T2DM.9 However, our investigations revealed that miR-30a-5p downregulation has not been widely studied in association with diabetes-related mechanisms. Further investigation into this gene will assist in elucidating its role in the onset and progression of diabetes.
Resveratrol has been extensively researched for its potential therapeutic benefits in obesity and diabetes.47 One key mechanism underlying its anti-diabetic effects is the activation of SIRT1, a protein that regulates various biological processes, including metabolism, inflammation, ageing and stress tolerance, through the deacetylation of transcription factors and histones.48 Previous research has demonstrated that SIRT1 activity and expression were markedly diminished in both in vitro and in vivo experimental models of DM.31,32 Nonetheless, treatment with RES was shown to activate the expression of SIRT1.49,50 In line with these findings, our study revealed that HG reduced SIRT1 mRNA and protein expression, whereas RES treatment increased their expression. Notably, RES treatment restored the HG-induced downregulation of miR-126-3p, miR-182-5p and miR-30a-5p, suggesting it may protect against miRNA dysregulation associated with hyperglycaemia.
While our findings highlight a potential role for miRNA modulation, it is important to note that RES is a pleiotropic compound. Resveratrol is known to exert its anti-diabetic effects through various signalling pathways beyond miRNA regulation, including AMP-activated protein kinase (AMPK), nuclear factor-kB (NF-kB) and peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α), which are implicated in oxidative stress response, mitochondria biogenesis and apoptosis.29,51,52,53 These pathways may function collaboratively with or independently of miRNA regulation to affect the cellular metabolism under hyperglycaemic conditions. Therefore, the modulation of these specific miRNAs likely represents one of several concurrent mechanisms through which RES may protect against hyperglycaemia-induced cellular dysfunction, rather than the sole pathway.
Furthermore, the dysregulation of miRNAs observed in the current study may itself be a consequence of these broader signalling changes. A key mechanistic link is the well-documented activation of the pro-inflammatory NF-kB pathway under HG conditions. For example, HG has been shown to activate NF-κB in HepG2 cells.54 Given that NF-kB is a known transcriptional regulator of numerous miRNAs, it is a plausible upstream mechanism responsible for the HG-induced downregulation of miR-126-3p, miR-182-5p and miR-30a-5p. Consequently, the ability of RES to restore normal miRNA levels could be directly linked to its well-characterised role as an inhibitor of NF-kB signalling.39,40,55 Zeinali et al.35 reported a correlation between the expression of miR-126-3p and inflammation in individuals with prediabetes and T2DM. Their studies demonstrated a notable decrease in this miRNA’s level in patients with prediabetes or T2DM compared with healthy individuals. Zampetaki et al.56 reported reduced plasma miR-126 in individuals with diabetes, suggesting that endothelial dysfunction and inflammation may contribute to this alteration.
MiR-126 regulates angiogenesis signalling and has been shown to target SPRED1.35 Suppression of miR-126 in patients with diabetes may increase SPRED1 expression, which, in turn, stimulates Interleukin 6 (IL-6), tumour necrosis factor alpha (TNF-α) and reactive oxygen species (ROS) expression, leading to endothelial dysfunction.57 Elevated glucose levels have been shown to increase SPRED1 mRNA expression, whereas RES treatment reduces it. These findings are consistent with previous research, which indicates that reduced miR-126 expression is associated with increased SPRED1 expression.57 Additionally, augmented miR-126-3p expression was concurrent with significantly lower SPRED1 expression.
The findings of the current study indicate that elevated levels of miR-126-3p expression induced by RES may represent a mechanism underlying its beneficial effects in diabetes. Resveratrol has been recognised for its anti-inflammatory properties and its ability to modulate miRNA expression. Previous research by Mahjabeen et al. showed a substantial increase in miR-126 expression in individuals with T2DM following RES supplementation.47 Consequently, RES-induced upregulation of miR-126-3p may contribute to its anti-inflammatory effects and improvements in endothelial function in patients with diabetes.
The regulatory function of miR-182-5p in maintaining glucose homeostasis likely operates through FOXO1, a gene that plays a key role in gluconeogenesis.34 Our results indicated that reduced miR-182-5p expression was associated with elevated FOXO1 and G6Pase mRNA levels, suggesting enhanced gluconeogenesis. Furthermore, the current study demonstrated that RES treatment markedly upregulated miR-182-5p expression. This increase was associated with reduced FOXO1 mRNA expression and subsequently, lower G6Pase mRNA levels, which align with a potential decrease in gluconeogenesis. These findings indicate that RES may influence glucose homeostasis by modulating miR-182-5p, which is inversely correlated with its predicted gene, FOXO1. The observed elevation of miR-182-5p by RES aligns with previous findings by Zuo et al.,58 who showed that miR-182-5p directly suppresses FOXO1 expression, resulting in reduced hepatic lipid accumulation associated with alcohol-related liver disease (ALD). These results suggest that RES may modulate miR-182-5p and its downstream targets to enhance glucose metabolism and maintain homeostasis in patients with diabetes.
The upregulation of miR-30a-5p by RES presents an interesting contrast to existing literature. A study in a rodent model has shown that glucotoxicity-induced upregulation of miR-30a-5p contributes to beta-cell dysfunction.15 This discrepancy may suggest the potential for cell line-specific functions of miR-30a-5p, where its functional outcome is likely determined by the upstream stimulus and the downstream target repertoire available in a given cellular environment. In support of a potential functional relationship in our model, RES treatment increased miR-30a-5p expression while decreasing Neurod1 mRNA expression in HepG2 cells. It is plausible that the RES-mediated reduction in Neurod1 is facilitated by miR-30a-5p; however, our data are correlative, and based on a prediction database, this causal relationship remains to be experimentally confirmed. Therefore, the implications of miR-30a-5p upregulation by RES require further investigations to determine if it contributes to its beneficial effects on glucose homeostasis or represents a compensatory mechanism. Overall, the results indicate that RES may effectively modulate the dysregulation of miR-126-3p, miR-182-5p and miR-30a-5p in diabetes. By counteracting HG-induced downregulation and potentially restoring their expression levels, RES may facilitate their normalisation and highlight them as a potential target for managing hyperglycaemia. Furthermore, RES treatment reversed the HG-induced alterations in miRNA levels and the mRNA expression of their predicted target genes.
Importantly, our study showed that RES increased SIRT1 expression, a key regulator of cellular processes. Previous studies have established that SIRT1 interacts with miRNAs in a bidirectional manner. Wang et al. revealed that miR-182 mediates SIRT1-induced diabetic corneal nerve regeneration. The overexpression of SIRT1 in trigeminal neurons was shown to elevate miR-182 expression.59 Furthermore, Li et al. showed that miR-126 mitigates oxidative injury via the SIRT1/Nrf2 pathway.60 In our study, RES concurrently increases miR-30a-5p, miR-126-3p and SIRT1. While miR-126-3p and miR-182-5p have been linked directly to SIRT1 in prior work,60,61 the role of miR-30a-5p in this context remains unclear. Although previous studies have reported miR-30a-5p as a negative regulator of SIRT1,60 our findings show that RES increased both miR-30a-5p and SIRT1 levels, contradicting previous results and suggesting a more complex relationship. Therefore, more studies are needed regarding this.
Study limitations
This study has several limitations. Firstly, all experiments were conducted in vitro, which may not fully capture the complexity of miRNA regulation in the pathophysiology of diabetes. Additionally, the statistical power of our findings is constrained by the number of independent biological replicates (n). Therefore, interpretation of ‘no significant difference’ should be made with caution, as it may reflect the limitation of the sample size rather than the true absence of a biological effect.
Secondly, we examined only the gene expressions of SPRED1, FOXO1, G6Pase and Neurod1. Future investigations should assess functional protein expression to determine potential correlation with gene expression. Thirdly, the functional relationships between miRNAs and their predicted target genes were inferred from a bioinformatic prediction tool and observed correlative expression changes. Direct validation methods, such as luciferase reporter assay or miRNA knockdown or overexpression assay, should be employed in future research.
Lastly, our study did not include vehicle control groups. Previous research indicated that DMSO can influence cellular metabolism in HepG2 cells.62 Although our observed effects are likely driven primarily by RES, the possibility of confounding or synergistic effects from DMSO cannot be excluded; therefore, future studies should incorporate vehicle controls to account for potential solvent effects.
Conclusion
Our in vitro research provides evidence supporting the potential involvement of specific miRNAs in glucoregulatory pathways. Furthermore, the findings indicate that miR-126-3p, miR-182-5p and miR-30a-5p may regulate the expression of SPRED1, FOXO1 and Neurod1, respectively. These results suggest that dysregulation of miRNA induced by HG levels may constitute a mechanism underlying metabolic disruption in cellular models. The reversal of this dysregulation by RES in the present model suggests a potential protective role of RES at the molecular level. Additional research in animal models and clinical studies is necessary to confirm these mechanisms and their significance in human T2DM.
Acknowledgements
The authors would like to express their gratitude to Prof. J.L. Marnewick for generously donating HepG2 cells for the experimental work. Abegail M. Tshivhase expresses gratitude to the DSI CSIR – Inter-bursary Support Programme for providing student funding.
This article is based on research originally conducted as part of Abegail M. Tshivhase’s doctoral thesis titled ‘Biochemical analysis and microRNA profiling in a high glucose in vitro model with resveratrol intervention’, submitted to the Faculty of Health & Wellness Sciences, Department of Biomedical Sciences, Cape Peninsula University of Technology in 2023. The thesis was supervised by Shanel Raghubeer and Tandi E. Matsha. The thesis was reworked, revised and adapted into a journal article for publication. The original thesis is available at: https://etd.cput.ac.za/handle/20.500.11838/4008.
This article is based on data from a larger study. A related article focusing on resveratrol attenuates high glucose-induced inflammation and improves glucose metabolism in HepG2 cells has been published in Scientific Reports, 14(1), p.1106. Another related article focusing on the protective role of resveratrol against high glucose-induced oxidative stress and apoptosis in HepG2 cells has been published in Food Science & Nutrition, 12 (5), p. 3574–3584. The present article addresses a distinct research question, focusing on the effect of resveratrol on hyperglycaemia-related microRNAs and their target genes in HepG2 cells.
Competing interests
The author reported that they received funding from the South African Medical Research Council (SAMRC), which may be affected by the research reported in the enclosed publication. The author has disclosed those interests fully and has implemented an approved plan for managing any potential conflicts arising from their involvement. The terms of these funding arrangements have been reviewed and approved by the affiliated university in accordance with its policy on objectivity in research.
CRediT authorship contribution
Abegail M. Tshivhase: Data curation, Formal analysis, Investigation, Methodology, Visualisation, Writing – original draft. Tandi Matsha: Funding acquisition, Investigation, Project administration, Supervision, Writing – review & editing. Shanel Raghubeer: Conceptualisation, Investigation, Methodology, Project administration, Supervision, Writing – review & editing. All authors reviewed the article, contributed to the discussion of results, approved the final version for submission and publication, and take responsibility for the integrity of its findings.
Data availability
The data used in the study are presented in this article and can be further requested from the corresponding author, Shanel Raghubeer.
Disclaimer
The views and opinions expressed in this article are those of the authors and are the product of professional research. The article does not necessarily reflect the official policy or position of any affiliated institution, funder, agency or that of the publisher. The authors are responsible for this article’s results, findings and content.
ReferencesHuangD-D, ShiG, JiangY, YaoC, ZhuC. A review on the potential of resveratrol in prevention and therapy of diabetes and diabetic complications. Biomed Pharmacother. 2020;125:109767. https://doi.org/10.1016/j.biopha.2019.109767SunH, SaeediP, KarurangaS, et al. IDF Diabetes Atlas: Global, regional and country-level diabetes prevalence estimates for 2021 and projections for 2045. Diabetes Res Clin Pract. 2022;183:109119. https://doi.org/10.1016/j.diabres.2021.109119International Diabetes Federation. IDF Diabetes Atlas. 10th ed. Brussels: International Diabetes Federation; 2021.ÖztürkE, ArslanAKK, YererMB, BishayeeA. Resveratrol and diabetes: A critical review of clinical studies. Biomed Pharmacother. 2017;95:230–234. https://doi.org/10.1016/j.biopha.2017.08.070SuM, ZhaoW, XuS, WengJ. Resveratrol in treating diabetes and its cardiovascular complications: A review of its mechanisms of action. Antioxidants (Basel). 2022;11(6): 1085. https://doi.org/10.3390/antiox11061085BartelDP. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 2004;116(2):281–297. https://doi.org/10.1016/S0092-8674(04)00045-5LewisBP, BurgeCB, BartelDP. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell. 2005;120(1):15–20. https://doi.org/10.1016/j.cell.2004.12.035WealeCJ, MatshaziDM, DavidsSFG, et al. Circulating miR-30a-5p and miR-182-5p in prediabetes and screen-detected diabetes mellitus. Diabetes Metab Syndr Obes. 2020;13:5037–5047. https://doi.org/10.2147/DMSO.S286081WealeCJ, MatshaziDM, DavidsSFG, et al. Expression profiles of circulating microRNAs in South African type 2 diabetic individuals on treatment. Front Genet. 2021;12:702410. https://doi.org/10.3389/fgene.2021.702410KarolinaDS, ArmugamA, TavintharanS, et al. MicroRNA 144 impairs insulin signaling by inhibiting the expression of insulin receptor substrate 1 in type 2 diabetes mellitus. PLoS One. 2011;6(8):e22839. https://doi.org/10.1371/journal.pone.0022839ZhouJ, MengY, TianS, et al. Comparative microRNA expression profiles of cynomolgus monkeys, rat, and human reveal that mir-182 is involved in T2D pathogenic processes. J Diabetes Res. 2014;2014:760397. https://doi.org/10.1155/2014/760397GrossDN, Van den HeuvelAPJ, BirnbaumMJ. The role of FoxO in the regulation of metabolism. Oncogene. 2008;27(16):2320–2336. https://doi.org/10.1038/onc.2008.25WangS, AuroraAB, JohnsonBA, et al. The endothelial-specific microRNA miR-126 governs vascular integrity and angiogenesis. Dev Cell. 2008;15(2):261–271. https://doi.org/10.1016/j.devcel.2008.07.002SessaR, SeanoG, di BlasioL, et al. The miR-126 regulates angiopoietin-1 signaling and vessel maturation by targeting p85β. Biochim Biophys Acta. 2012;1823(10):1925–1935. https://doi.org/10.1016/j.bbamcr.2012.07.011KimJ-W, YouY-H, JungS, et al. MiRNA-30a-5p-mediated silencing of Beta2/NeuroD expression is an important initial event of glucotoxicity-induced beta cell dysfunction in rodent models. Diabetologia. 2013;56(4):847–855. https://doi.org/10.1007/s00125-012-2812-xPordzikJ, JakubikD, Jarosz-PopekJ, et al. Significance of circulating microRNAs in diabetes mellitus type 2 and platelet reactivity: Bioinformatic analysis and review. Cardiovasc Diabetol. 2019;18(1):113. https://doi.org/10.1186/s12933-019-0918-x.SummerlinN, SooE, ThakurS, et al. Resveratrol nanoformulations: Challenges and opportunities. Int J Pharm. 2015;479(2):282–290. https://doi.org/10.1016/j.ijpharm.2015.01.003SoufiFG, Mohammad-NejadD, AhmadiehH. Resveratrol improves diabetic retinopathy possibly through oxidative stress – Nuclear factor κB – Apoptosis pathway. Pharmacol Rep. 2012;64(6):1505–1514. https://doi.org/10.1016/S1734-1140(12)70948-9TuranB, TuncayE, VassortG. Resveratrol and diabetic cardiac function: Focus on recent in vitro and in vivo studies. J Bioenerg Biomembr. 2012;44(2):281–296. https://doi.org/10.1007/s10863-012-9429-0SinghCK, KumarA, LaVoieHA, DiPetteDJ, SinghUS. Diabetic complications in pregnancy: Is resveratrol a solution?Exp Biol Med (Maywood). 2013;238(5):482–490. https://doi.org/10.1177/1535370212473704VallianouNG, EvangelopoulosA, KazazisC. Resveratrol and diabetes. Rev Diabet Stud. 2014;10(4):236–242. https://doi.org/10.1900/RDS.2013.10.236OyenihiOR, OyenihiAB, AdeyanjuAA, OguntibejuOO. Antidiabetic effects of resveratrol: The way forward in its clinical utility. J Diabetes Res. 2016;2016:9737483. https://doi.org/10.1155/2016/9737483BrasnyóP, MolnárGA, MohásM, et al. Resveratrol improves insulin sensitivity, reduces oxidative stress and activates the Akt pathway in type 2 diabetic patients. Br J Nutr. 2011;106(3):383–389. https://doi.org/10.1017/S0007114511000316BhattJK, ThomasS, NanjanMJ. Resveratrol supplementation improves glycemic control in type 2 diabetes mellitus. Nutr Res. 2012;32(7):537–541. https://doi.org/10.1016/j.nutres.2012.06.003CrandallJP, OramV, TrandafirescuG, et al. Pilot study of resveratrol in older adults with impaired glucose tolerance. J Gerontol A Biol Sci Med Sci. 2012;67(12):1307–1312. https://doi.org/10.1093/gerona/glr235SzkudelskiT, SzkudelskaK. Resveratrol and diabetes: From animal to human studies. Biochim Biophys Acta. 2015;1852(6):1145–1154. https://doi.org/10.1016/j.bbadis.2014.10.013HuangX, SunJ, ChenG, et al. Resveratrol promotes diabetic wound healing via SIRT1-FOXO1-c-Myc signaling pathway-mediated angiogenesis. Front Pharmacol. 2019;10:421. https://doi.org/10.3389/fphar.2019.00421YarAS, MenevseS, AlpE. The effects of resveratrol on cyclooxygenase-1 and-2, nuclear factor kappa beta, matrix metalloproteinase-9, and sirtuin 1 mRNA expression in hearts of streptozotocin-induced diabetic rats. Genet Mol Res. 2011;10(4):2962–2975. https://doi.org/10.4238/2011.November.29.7LagougeM, ArgmannC, Gerhart-HinesZ, et al. Resveratrol improves mitochondrial function and protects against metabolic disease by activating SIRT1 and PGC-1α. Cell. 2006;127(6):1109–1122. https://doi.org/10.1016/j.cell.2006.11.013ChaudharyN, PflugerPT. Metabolic benefits from Sirt1 and Sirt1 activators. Curr Opin Clin Nutr Metab Care. 2009;12(4);431–437. https://doi.org/10.1097/MCO.0b013e32832cdaaeMilneJC, LambertPD, SchenkS, et al. Small molecule activators of SIRT1 as therapeutics for the treatment of type 2 diabetes. Nature. 2007;450(7170):712–716. https://doi.org/10.1038/nature06261de KreutzenbergSV, CeolottoG, PapparellaI, et al. Downregulation of the longevity-associated protein sirtuin 1 in insulin resistance and metabolic syndrome: Potential biochemical mechanisms. Diabetes. 2010;59(4):1006–1015. https://doi.org/10.2337/db09-1187Ghafouri-FardS, ShooreiH, HussenBM, et al. Interaction between SIRT1 and non-coding RNAs in different disorders. Front Genet. 2023;14:1121982. https://doi.org/10.3389/fgene.2023.1121982KaurP, KotruS, SinghS, BeheraBS, MunshiA. Role of miRNAs in the pathogenesis of T2DM, insulin secretion, insulin resistance, and β cell dysfunction: The story so far. J Physiol Biochem. 2020;76(4):485–502. https://doi.org/10.1007/s13105-020-00760-2ZeinaliF, ZarchSMA, Jahan-MihanA, et al. Circulating microRNA-122, microRNA-126-3p and microRNA-146a are associated with inflammation in patients with pre-diabetes and type 2 diabetes mellitus: A case control study. PLoS One. 2021;16(6):e0251697. https://doi.org/10.1371/journal.pone.0251697LiX, LiY, HaoQ, JinJ, WangY. Metabolic mechanisms orchestrated by Sirtuin family to modulate inflammatory responses. Front Immunol. 2024;15:1448535. https://doi.org/10.3389/fimmu.2024.1448535MihanfarA, AkbarzadehM, DarbandSG, SadighparvarS, MajidiniaM. SIRT1: A promising therapeutic target in type 2 diabetes mellitus. Arch Physiol Biochem. 2024;130(1):13–28. https://doi.org/10.1080/13813455.2021.1956976TshivhaseAM, MatshaT, RaghubeerS. The protective role of resveratrol against high glucose-induced oxidative stress and apoptosis in HepG2 cells. Food Sci Nutr. 2024;12(5):3574–3584. https://doi.org/10.1002/fsn3.4027TshivhaseAM, MatshaT, RaghubeerS. Resveratrol attenuates high glucose-induced inflammation and improves glucose metabolism in HepG2 cells. Sci Rep. 2024;14:1106. https://doi.org/10.1038/s41598-023-50084-6TshivhaseAM. Biochemical analysis and microRNA profiling in a high glucose in vitro model with resveratrol intervention [homepage on the Internet] [Doctoral dissertation]. Cape Peninsula University of Technology; 2023[cited 2026 Feb 20]. Available from: https://etd.cput.ac.za/handle/20.500.11838/4008Baselga-EscuderoL, BladeC, Ribas-LatreA, et al. Resveratrol and EGCG bind directly and distinctively to miR-33a and miR-122 and modulate divergently their levels in hepatic cells. Nucleic Acids Res. 2014;42(2):882–892. https://doi.org/10.1093/nar/gkt1011RaghubeerS, NagiahS, PhulukdareeA, ChuturgoonA. The phytoalexin resveratrol ameliorates ochratoxin A toxicity in human embryonic kidney (HEK293) cells. J Cell Biochem. 2015;116(12):2947–2955. https://doi.org/10.1002/jcb.25242KhanMA, ChenH-C, WanX-X, et al. Regulatory effects of resveratrol on antioxidant enzymes: A mechanism of growth inhibition and apoptosis induction in cancer cells. Mol Cells. 2013;35(3):219–225. https://doi.org/10.1007/s10059-013-2259-zMassimiM, TomassiniA, SciubbaF, et al. Effects of resveratrol on HepG2 cells as revealed by 1H-NMR based metabolic profiling. Biochim Biophys Acta. 2012;1820(1):1–8. https://doi.org/10.1016/j.bbagen.2011.10.005LivakKJ, SchmittgenTD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25(4):402–408. https://doi.org/10.1006/meth.2001.1262Ait-AissaK, NguyenQM, GabaniM, et al. MicroRNAs and obesity-induced endothelial dysfunction: Key paradigms in molecular therapy. Cardiovasc Diabetol. 2020;19(1):136. https://doi.org/10.1186/s12933-020-01107-3MahjabeenW, KhanDA, MirzaSA. Role of resveratrol supplementation in regulation of glucose hemostasis, inflammation and oxidative stress in patients with diabetes mellitus type 2: A randomized, placebo-controlled trial. Complement Ther Med. 2022;66:102819. https://doi.org/10.1016/j.ctim.2022.102819MengT, QinW, LiuB. SIRT1 antagonizes oxidative stress in diabetic vascular complication. Front Endocrinol (Lausanne). 2020;11:568861. https://doi.org/10.3389/fendo.2020.568861CaoM-M, LuX, LiuG-D, et al. Resveratrol attenuates type 2 diabetes mellitus by mediating mitochondrial biogenesis and lipid metabolism via Sirtuin type 1. Exp Ther Med. 2018;15(1):576–584. https://doi.org/10.3892/etm.2017.5400GohKP, LeeHY, LauDP, et al. Effects of resveratrol in patients with type 2 diabetes mellitus on skeletal muscle SIRT1 expression and energy expenditure. Int J Sport Nutr Exerc Metab. 2014;24(1):2–13. https://doi.org/10.1123/ijsnem.2013-0045ZhangT, ChiY, RenY, et al. Resveratrol reduces oxidative stress and apoptosis in podocytes via Sir2-related enzymes, Sirtuins1 (SIRT1)/peroxisome proliferator-activated receptor γ co-activator 1α (PGC-1α) axis. Med Sci Monit. 2019;25:1220–1231. https://doi.org/10.12659/MSM.911714ZangM, XuS, Maitland-ToolanKA, et al. Polyphenols stimulate AMP-activated protein kinase, lower lipids, and inhibit accelerated atherosclerosis in diabetic LDL receptor-deficient mice. Diabetes. 2006;55(8):2180–2191. https://doi.org/10.2337/db05-1188CsiszarA, LabinskyyN, PintoJT, et al. Resveratrol induces mitochondrial biogenesis in endothelial cells. Am J Physiol Heart Circ Physiol. 2009;297(1):H13–H20. https://doi.org/10.1152/ajpheart.00368.2009PanahiG, PasalarP, ZareM, RizzutoR, MeshkaniR. High glucose induces inflammatory responses in HepG2 cells via the oxidative stress-mediated activation of NF-κB, and MAPK pathways in HepG2 cells. Arch Physiol Biochem. 2018;124(5):468–474. https://doi.org/10.1080/13813455.2018.1427764RenZ, WangL, CuiJ, et al. Resveratrol inhibits NF-κB signaling through suppression of p65 and I B kinase activities. Pharmazie. 2013;68(8):689–694.ZampetakiA, KiechlS, DrozdovI, et al. Plasma microRNA profiling reveals loss of endothelial miR-126 and other microRNAs in type 2 diabetes. Circ Res. 2010;107(6):810–817. https://doi.org/10.1161/CIRCRESAHA.110.226357LiY, ZhouQ, PeiC-Z, et al. Hyperglycemia and advanced glycation end products regulate miR-126 expression in endothelial progenitor cells. J Vasc Res. 2016;53(1–2):94–104. https://doi.org/10.1159/000448713ZuoZ, LiY, ZengC, et al. Integrated analyses identify key molecules and reveal the potential mechanism of miR-182-5p/FOXO1 axis in alcoholic liver disease. Front Med (Lausanne). 2021;8:767584. https://doi.org/10.3389/fmed.2021.767584WangY, ZhaoX, WuX, et al. MicroRNA-182 mediates Sirt1-induced diabetic corneal nerve regeneration. Diabetes. 2016;65(7):2020–2031. https://doi.org/10.2337/db15-1283LiJ, YangC, WangY. MiR-126 overexpression attenuates oxygen-glucose deprivation/reperfusion injury by inhibiting oxidative stress and inflammatory response via the activation of SIRT1/Nrf2 signaling pathway in human umbilical vein endothelial cells. Mol Med Rep. 2021;23(2):165. https://doi.org/10.3892/mmr.2020.11804CuiS, SoniCB, XieJ, et al. MiR-30a-5p accelerates adipogenesis by negatively regulating Sirtuin 1. Int J Clin Exp Pathol [serial online]. 2018;11(11):5203–5212. Available from: https://pubmed.ncbi.nlm.nih.gov/31949600NikolaouN, GreenCJ, GunnPJ, et al. Optimizing human hepatocyte models for metabolic phenotype and function: Effects of treatment with dimethyl sulfoxide (DMSO). Physiol Rep. 2016;4(21):e12944. https://doi.org/10.14814/phy2.12944
How to cite this article: Tshivhase AM, Matsha T, Raghubeer S. The effect of resveratrol on hyperglycaemia-related microRNAs in HepG2 cells. J Med Lab Sci Technol S Afr. 2026;8(1), a133. https://doi.org/10.4102/jmlstsa.v8i1.133